|
Left Crispr |
Right Crispr |
| Crispr ID |
1166424728 |
1166424739 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:42667565-42667587
|
19:42667608-42667630
|
| Sequence |
CCAGCCTCAACACCACCCGTAGG |
ACAAAGGAATGAGCAGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 26, 2: 15, 3: 10, 4: 147} |
{0: 1, 1: 23, 2: 18, 3: 60, 4: 477} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|