ID: 1166446832_1166446835

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1166446832 1166446835
Species Human (GRCh38) Human (GRCh38)
Location 19:42865429-42865451 19:42865455-42865477
Sequence CCAAATAACTGCAGGTGGACCTG AATGTCAGGCCCTCTACAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 28, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!