ID: 1166482749_1166482757

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166482749 1166482757
Species Human (GRCh38) Human (GRCh38)
Location 19:43187325-43187347 19:43187346-43187368
Sequence CCAGGAACCCCGCGGGACATGGC GCTCGTTGAGACGCAGGAGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 5, 2: 2, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!