|
Left Crispr |
Right Crispr |
| Crispr ID |
1166490907 |
1166490914 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:43259521-43259543
|
19:43259564-43259586
|
| Sequence |
CCCCCCTATATGTGATTTCTCTG |
GTTCTAGAGATGAGTAATAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 4, 3: 15, 4: 164} |
{0: 1, 1: 7, 2: 4, 3: 16, 4: 206} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|