ID: 1166499814_1166499823

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166499814 1166499823
Species Human (GRCh38) Human (GRCh38)
Location 19:43332376-43332398 19:43332412-43332434
Sequence CCTCTGACTGCTGTTTAGCAAAG CTGATGGCGCTGTCCTGGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 16, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!