ID: 1166513337_1166513340

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1166513337 1166513340
Species Human (GRCh38) Human (GRCh38)
Location 19:43426206-43426228 19:43426231-43426253
Sequence CCTTAATTTGCATTAATCCACAC TAATTTGCATGTAATTGAAGTGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 9, 3: 58, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!