ID: 1166564354_1166564372

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1166564354 1166564372
Species Human (GRCh38) Human (GRCh38)
Location 19:43754646-43754668 19:43754699-43754721
Sequence CCCCTTACCTAACGCGGCTGCTG CCGTGACGGGAGTCGGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!