ID: 1166577450_1166577456

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166577450 1166577456
Species Human (GRCh38) Human (GRCh38)
Location 19:43855664-43855686 19:43855691-43855713
Sequence CCAACACCAATGGGGCAGGGATG CTGCCAAGGGTGGAGAGTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 169, 4: 4500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!