ID: 1166592445_1166592448

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166592445 1166592448
Species Human (GRCh38) Human (GRCh38)
Location 19:44012191-44012213 19:44012212-44012234
Sequence CCTCAGGCCTCAAGTCCTCAACT CTGCACCAGAGTGTCCACGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 244} {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!