ID: 1166608793_1166608799

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166608793 1166608799
Species Human (GRCh38) Human (GRCh38)
Location 19:44170115-44170137 19:44170165-44170187
Sequence CCCAGCTGTTAAAAATACCATTT TCTTTTTCAAGTAAGAGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 310} {0: 1, 1: 0, 2: 1, 3: 36, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!