ID: 1166674073_1166674081

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1166674073 1166674081
Species Human (GRCh38) Human (GRCh38)
Location 19:44728607-44728629 19:44728625-44728647
Sequence CCATCCACCTTGCCCTTGCAAAG CAAAGTGCTGGGATTACAGGCGG
Strand - +
Off-target summary No data {0: 1569, 1: 1825, 2: 1354, 3: 1301, 4: 2386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!