ID: 1166674073_1166674082

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1166674073 1166674082
Species Human (GRCh38) Human (GRCh38)
Location 19:44728607-44728629 19:44728626-44728648
Sequence CCATCCACCTTGCCCTTGCAAAG AAAGTGCTGGGATTACAGGCGGG
Strand - +
Off-target summary No data {0: 1754, 1: 2709, 2: 2278, 3: 2013, 4: 2868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!