ID: 1166679225_1166679232

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1166679225 1166679232
Species Human (GRCh38) Human (GRCh38)
Location 19:44757148-44757170 19:44757166-44757188
Sequence CCCGACCTGCCTGCGAGCCCTGC CCTGCTGGACAGCGCAGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 345} {0: 1, 1: 0, 2: 3, 3: 28, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!