ID: 1166679859_1166679879

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1166679859 1166679879
Species Human (GRCh38) Human (GRCh38)
Location 19:44759548-44759570 19:44759595-44759617
Sequence CCTTTGCTGGGGTCCTCCGAGGC CCAGCTCCAGGAGGCAGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 160} {0: 1, 1: 0, 2: 6, 3: 99, 4: 644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!