ID: 1166685387_1166685404

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166685387 1166685404
Species Human (GRCh38) Human (GRCh38)
Location 19:44793450-44793472 19:44793498-44793520
Sequence CCTTTCCCTCCCGACCTCCCCCA TTCTGCCGCTGCGAGATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 129, 4: 1428} {0: 1, 1: 0, 2: 0, 3: 54, 4: 3885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!