ID: 1166725107_1166725110

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1166725107 1166725110
Species Human (GRCh38) Human (GRCh38)
Location 19:45022159-45022181 19:45022183-45022205
Sequence CCGACGGCATCTGCAGGGTGCGG TCCGGCCTCACGTCAGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95} {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!