ID: 1166740074_1166740085

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1166740074 1166740085
Species Human (GRCh38) Human (GRCh38)
Location 19:45109313-45109335 19:45109350-45109372
Sequence CCCATCTCAGTGTGAACAGCTTG AGGGCTGGGGCCCTCAGAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!