ID: 1166748235_1166748256

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1166748235 1166748256
Species Human (GRCh38) Human (GRCh38)
Location 19:45152060-45152082 19:45152113-45152135
Sequence CCGACGGGGGCGCCCTGGAGGCG TCGCGGGTAGGGGACTTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!