ID: 1166782460_1166782475

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166782460 1166782475
Species Human (GRCh38) Human (GRCh38)
Location 19:45349644-45349666 19:45349680-45349702
Sequence CCTGCCCTGGGGAGGCACCCATT GTGAGCAACGTGAGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 220} {0: 1, 1: 0, 2: 1, 3: 30, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!