ID: 1166783045_1166783058

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1166783045 1166783058
Species Human (GRCh38) Human (GRCh38)
Location 19:45352226-45352248 19:45352277-45352299
Sequence CCATCTGCCGCAGGAAGTACTTG GGTTGAGGTTGGCATCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102} {0: 1, 1: 0, 2: 2, 3: 17, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!