ID: 1166783047_1166783050

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1166783047 1166783050
Species Human (GRCh38) Human (GRCh38)
Location 19:45352233-45352255 19:45352251-45352273
Sequence CCGCAGGAAGTACTTGGCCACCT CACCTGGACACCCTCGTCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 157} {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!