ID: 1166783049_1166783061

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1166783049 1166783061
Species Human (GRCh38) Human (GRCh38)
Location 19:45352250-45352272 19:45352296-45352318
Sequence CCACCTGGACACCCTCGTCCACG GAGGTGCTCCTGGATCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129} {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!