ID: 1166783057_1166783060

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166783057 1166783060
Species Human (GRCh38) Human (GRCh38)
Location 19:45352268-45352290 19:45352295-45352317
Sequence CCACGGTCAGGTTGAGGTTGGCA TGAGGTGCTCCTGGATCCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 5, 3: 20, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!