ID: 1166794621_1166794638

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166794621 1166794638
Species Human (GRCh38) Human (GRCh38)
Location 19:45419141-45419163 19:45419189-45419211
Sequence CCCAGGCTCTGCAGCCGCCCATG TAGCGGAGGCTGGTGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 250} {0: 1, 1: 0, 2: 5, 3: 47, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!