ID: 1166803421_1166803423

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1166803421 1166803423
Species Human (GRCh38) Human (GRCh38)
Location 19:45471387-45471409 19:45471403-45471425
Sequence CCTGGGTTGAGAACTAGACGTTC GACGTTCCACACATGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65} {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!