ID: 1166804023_1166804037

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166804023 1166804037
Species Human (GRCh38) Human (GRCh38)
Location 19:45474156-45474178 19:45474192-45474214
Sequence CCAGCCTAGGACGCCAACTTCTC CCTCACATCCTCTCCAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93} {0: 1, 1: 0, 2: 0, 3: 48, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!