ID: 1166808334_1166808346

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1166808334 1166808346
Species Human (GRCh38) Human (GRCh38)
Location 19:45499987-45500009 19:45500029-45500051
Sequence CCCTGGGGCCCCTAGGCCTTCTG GCTAGCACTGGACGCAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 285} {0: 1, 1: 0, 2: 9, 3: 85, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!