ID: 1166837850_1166837857

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1166837850 1166837857
Species Human (GRCh38) Human (GRCh38)
Location 19:45678099-45678121 19:45678118-45678140
Sequence CCACGCTGACGCTGGTGCCCCTG CCTGCTGGGTGTCCACGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174} {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!