ID: 1166837892_1166837899

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166837892 1166837899
Species Human (GRCh38) Human (GRCh38)
Location 19:45678269-45678291 19:45678305-45678327
Sequence CCTCCTCCCCAGAGGGGCACGAA CTCTGGTGCAGCCACTGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160} {0: 1, 1: 1, 2: 1, 3: 14, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!