ID: 1166852779_1166852791

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1166852779 1166852791
Species Human (GRCh38) Human (GRCh38)
Location 19:45768454-45768476 19:45768499-45768521
Sequence CCCGCGCGCGCAACACCGGGTCG GGGGCAGTGCGCCCAGGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15} {0: 1, 1: 0, 2: 3, 3: 30, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!