ID: 1166867952_1166867959

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1166867952 1166867959
Species Human (GRCh38) Human (GRCh38)
Location 19:45852444-45852466 19:45852485-45852507
Sequence CCTACACCACACCCCTTTCTCTT CAGGAAGTTGTCCAGTAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 571} {0: 1, 1: 0, 2: 2, 3: 10, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!