ID: 1166869785_1166869802

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1166869785 1166869802
Species Human (GRCh38) Human (GRCh38)
Location 19:45864308-45864330 19:45864347-45864369
Sequence CCGCCTCCCGCGGCGCTCGGGAC GTCGGACGGGCGGGCGCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 133} {0: 1, 1: 0, 2: 4, 3: 29, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!