ID: 1166873849_1166873854

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1166873849 1166873854
Species Human (GRCh38) Human (GRCh38)
Location 19:45885709-45885731 19:45885733-45885755
Sequence CCACGGCATCTTGGGCAGGTCGC CAGGTAGCACCACTGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 77} {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!