ID: 1166873963_1166873968

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1166873963 1166873968
Species Human (GRCh38) Human (GRCh38)
Location 19:45886122-45886144 19:45886139-45886161
Sequence CCTCCACCTCCTTCTTCTGCCCC TGCCCCAGAGGCCGCTTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 440, 4: 3506} {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!