ID: 1166948306_1166948307

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1166948306 1166948307
Species Human (GRCh38) Human (GRCh38)
Location 19:46410739-46410761 19:46410753-46410775
Sequence CCTTTATCAAGCTGAGCACCTTG AGCACCTTGAGTTGCATTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179} {0: 1, 1: 0, 2: 2, 3: 9, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!