ID: 1166948474_1166948483

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1166948474 1166948483
Species Human (GRCh38) Human (GRCh38)
Location 19:46411675-46411697 19:46411715-46411737
Sequence CCCTGTGACCTCTGGTCAGCTGG TATCTGCAGCCTCTTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 17, 4: 235} {0: 1, 1: 4, 2: 4, 3: 52, 4: 1083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!