ID: 1166976752_1166976759

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1166976752 1166976759
Species Human (GRCh38) Human (GRCh38)
Location 19:46609427-46609449 19:46609449-46609471
Sequence CCTCCCCAGATCCCCTTGGGGAG GCCTCTGCCCTCCTCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 262} {0: 1, 1: 3, 2: 51, 3: 194, 4: 1086}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!