ID: 1166983913_1166983927

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1166983913 1166983927
Species Human (GRCh38) Human (GRCh38)
Location 19:46648796-46648818 19:46648847-46648869
Sequence CCGAGCACTCGGAGTCGCTGCCC GAGCTGACGGGGACGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 174} {0: 1, 1: 0, 2: 0, 3: 23, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!