ID: 1166992945_1166992950

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1166992945 1166992950
Species Human (GRCh38) Human (GRCh38)
Location 19:46704220-46704242 19:46704246-46704268
Sequence CCTGGCAAACGGTGGGCCGTGTA CTGTGGATGAGGAAGGTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36} {0: 1, 1: 0, 2: 5, 3: 44, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!