ID: 1166998842_1166998855

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1166998842 1166998855
Species Human (GRCh38) Human (GRCh38)
Location 19:46733052-46733074 19:46733096-46733118
Sequence CCTCGATCTGTTTCACCAGCAGC GCAGGGCCTGGTGGAGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145} {0: 1, 1: 0, 2: 3, 3: 72, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!