ID: 1167002812_1167002824

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167002812 1167002824
Species Human (GRCh38) Human (GRCh38)
Location 19:46755989-46756011 19:46756026-46756048
Sequence CCCGCTATGGCGCAGCCCCCGCC CGCCCTGGACGGAGATGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 168} {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!