ID: 1167019123_1167019133

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1167019123 1167019133
Species Human (GRCh38) Human (GRCh38)
Location 19:46861167-46861189 19:46861214-46861236
Sequence CCGGGATTTTGGAGGCCGGGGCC GTGCGCGAGCTCACGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 569} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!