ID: 1167022374_1167022379

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1167022374 1167022379
Species Human (GRCh38) Human (GRCh38)
Location 19:46887633-46887655 19:46887649-46887671
Sequence CCCACTTCCCTCCTTCAACTCAG AACTCAGTGCTCTAACCATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!