ID: 1167033329_1167033338

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1167033329 1167033338
Species Human (GRCh38) Human (GRCh38)
Location 19:46978128-46978150 19:46978173-46978195
Sequence CCCCCGAGGCCACATGTTGAGAA TTATCCTAGATTGCAGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!