ID: 1167040618_1167040629

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1167040618 1167040629
Species Human (GRCh38) Human (GRCh38)
Location 19:47020828-47020850 19:47020852-47020874
Sequence CCAGCCCCGGGCCGGCTAGGGTG GAGCTGAGGCCTCCAGGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 140} {0: 1, 1: 1, 2: 2, 3: 35, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!