ID: 1167056073_1167056101

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1167056073 1167056101
Species Human (GRCh38) Human (GRCh38)
Location 19:47112369-47112391 19:47112422-47112444
Sequence CCTCCTCCTCTTCCTCCCCCCGG ACCTGTCGTCAGGGAGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 48, 3: 488, 4: 3650} {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!