ID: 1167074255_1167074272

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1167074255 1167074272
Species Human (GRCh38) Human (GRCh38)
Location 19:47239521-47239543 19:47239555-47239577
Sequence CCGGGAGGCTGGACCGGGGCCGG GCGGGGGCGCGGGCGTCCGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 63, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!