ID: 1167075187_1167075195

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1167075187 1167075195
Species Human (GRCh38) Human (GRCh38)
Location 19:47244198-47244220 19:47244226-47244248
Sequence CCGCCCTGGTTCGGCACGAGAGC CGCTCGGGCCAGGCGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 35} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!