ID: 1167087749_1167087763

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1167087749 1167087763
Species Human (GRCh38) Human (GRCh38)
Location 19:47321877-47321899 19:47321909-47321931
Sequence CCCACTTCCCTCCACCCCCACAC GTCCCTAACCCCTGGCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 172, 4: 1614} {0: 1, 1: 0, 2: 4, 3: 19, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!