ID: 1167103619_1167103638

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167103619 1167103638
Species Human (GRCh38) Human (GRCh38)
Location 19:47418677-47418699 19:47418728-47418750
Sequence CCCAGGAACAGAGGAGAGAGACT ATAGAGAGGCAGAAAGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 404} {0: 1, 1: 0, 2: 18, 3: 304, 4: 2792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!